Optimizing Polymeric Micelle Properties to Enhance Cas9-Mediated Gene Knockdown

Introduction: Gene editing technologies hold unlocked potential to cure genetic diseases due to the ability to target specific DNA sequences and induce double-stranded breaks with high precision. Clustered regularly interspaced short palindromic repeats-associated protein 9 (CRISPR-Cas9) is the most popular gene editing technology due to its ease of design and high efficiency and specificity. However, despite its promise, Cas9's clinical translation is hindered by being an immunogenic protein, requiring an efficient delivery vehicle . Viral vectors have been used for delivering CRISPR-Cas9 to targeted genes as a legitimate treatment for these genetic disorders, but their use is limited due to safety concerns. Non-viral techniques have become increasingly popular following the success of the COVID-19 vaccine due to their higher safety profiles. Still, this method has not yet been shown to reach the efficiency levels seen in viral methods. We investigate using self-assembling polymer-based micelle nanoparticles as an effective encapsulation method and drug delivery system for the Cas9 ribonucleoprotein (RNP). The modification with a positively charged peptide enhanced loading capacity and facilitated cellular uptake, helping to close the efficiency gap. This multifaceted research project aims to develop and validate a cutting-edge nonviral delivery platform for Cas9 RNPs encapsulated within polymeric micelles. By addressing the challenges of Cas9 delivery, optimizing nanoparticle characteristics, and evaluating its effectiveness in an in vivo model, this study's objectives are to significantly advance the field of gene editing, with broad implications for therapeutic applications and potential breakthroughs in treating genetic diseases.

Materials and

Methods: Polyethylene glycol(5K) and polylactic acid(5K) (PEG-b-PLA) micelles were synthesized through the established film rehydration method. Micelles were characterized through dynamic light scattering (DLS) to determine size, polydispersity index (PDI), and zeta potential. Transmission electron microscopy (TEM) was used to confirm micelle formation (Fig. 1D). Using maleimide bioconjugation chemistry, a positively charged peptide, Transactivator of transcription for the human immunodeficiency virus (TAT), was added to enhance endocytosis and lysosomal escape. We designed two distinct guide RNAs (gRNAs) (CCATGGCACGGGCAGCTTGCCGG targeting GFP (gRNA-GFP) and TCCACCCCATTGACGTCAATGGG targeting the CMV promoter (gRNA-CMV)). We created Cas9 RNPs by combining the gRNA with Cas9 at 1:1. Cas9 RNPs were tested for their ability to knockdown green fluorescence protein (GFP) in Human Embryonic Kidney (HEK) 293-GFP cells via electroporation. Micelles were encapsulated with our top-performing Cas9 RNP and a gel shift assay was used to visualize and calculate encapsulation efficiency. The pH-responsive release behavior of PEG-b-PLA micelles was observed by detecting FITC-BSA, a fluorescent protein, in a buffer mimicking an early endosome (pH 5.5) and compared to normal conditions (pH 7.4). Nile Red, a hydrophobic fluorescent protein, assessed loading, release, and lysosomal escape via immunostaining. Having confirmed desirable encapsulation and release performance, we tested micelle-facilitated gene knockdown in HEK293-GFP cells over 3 days. We confirmed fluorescent knockdown visually using fluorescent microscopy and quantified using flow cytometry to compare mean fluorescent intensities (MFI). The cytotoxicity of the system was tested using a standard MTS assay.

Results, Conclusions, and Discussions: Micelle synthesis was optimized for the desired size and PDI to maximize cellular entry. Unloaded PEG-b-PLA micelles have an average size of 52.24 ± 0.13 nm (Fig. 1A) with an average PDI of 0.132 ± 0.016. Adding TAT increased the average size and PDI to 117.3 ± 4.77 nm (Fig. 1B) and 0.281 ± 0.010 respectively. TAT increased the surface charge from -16.4 mV to 3.51 mV (Fig. 1C). Using electroporation, we confirmed that the gRNA-GFP in our Cas9 RNP led to the greatest knockdown at 64% after 3 days and was used in further studies. PEG-b-PLA micelles encapsulated Cas9 RNP at an efficiency of 73.33 ± 3.06 % with a maximum loaded content of 7.6 µg Cas9 RNP per 15 mg polymer (Fig. 1E). Untagged and TAT-modified PEG-b-PLA micelles demonstrated the encapsulation and sustained release of FITC-BSA over 5 days, with faster release observed under lower pH conditions (Fig. 1F), suggesting the potential for hydrolytic cleavage-mediated Cas9 RNP delivery. Cellular uptake was visualized and then quantified by flow cytometry, which showed MFI values around 35,000 at the highest dose for both untagged and TAT-tagged systems. Immunostaining provided evidence of our system's ability to enter and escape the endosome effectively. Treatment of HEK293-GFP cells with our formulated Cas9 RNP resulted in noticeable fluorescent knockdown compared to controls after a 3-day incubation period (Fig. 1G). Furthermore, dose-dependent studies revealed that higher concentrations of Cas9 RNP led to a more efficient knockdown, confirmed by flow cytometry analysis. An MTS assay conducted across varying Cas9 RNP concentrations showed no significant cytotoxicity, 88% cell viability at the highest dose, affirming the biocompatibility and safety of our delivery system.

Our study presents a promising trajectory toward enhancing the efficacy of non-viral delivery methods for encapsulating and releasing Cas9 RNP in therapeutic gene editing. The system we developed showcases favorable attributes regarding size, cellular uptake, and controlled drug release, rendering it a viable candidate for various clinical applications. To our knowledge, this is the first demonstration of using polymeric micelles for Cas9 RNP delivery, laying the foundation for these systems to increase their clinical use.

Acknowledgements (Optional):